Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CJ0385
Clone ID CJ0385
Vector pGT0lxrT2
Project sanger

Sequence tag CJ0385
Sequence
TCACCAGGAAGCAGGATGCCCATGGCTGGCTTGCAGGTGGGACCTCCTGCCGGTTCCCCATTTGGCACAGCTGCTCCGCT
CCGACCTGGCATGCCACCTACCATGATGGATCCATTCCGAAAACGCCTGCTTGTGCCTCAGGCCCAGCCCCCGATGCCTG
CCCAGCGCCGAGGGTTAAAGAGGAGGAAGATGGCAGATAAGGTTCTACCTCAGCGAATCCGGGAGCTTGTCCCAGAGTCT
CAGGCATACATGGATCTTTTAGCTTTCGAGAGGAAGCTGGACCAGACCATCGCTCGCAAGCGGATGGAGATTCAAGAGGC
CATCAAGAAGCCTCTGACG
Sequence Type mRNA
Unitrap ID UNI949

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106128205..106128820 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078619 (Smarcd2) NP_114084 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 Gene [Source:MGI (curated);Acc:Smarcd2-001]

 
Come back to gene ENSMUSG00000078619


For any suggestions or comments, please send an email to unitrap@crg.es