Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10063C1
Clone ID IST10063C1
Vector VICTR75
Project tigm

Sequence tag IST10063C1HMR1
Sequence
CAGTGAAACGAGTCAATTCAAACNNGGTTTGAATAAAGGCAGGTTTCTTGGGAAGCAGCTCTGGGGCGAGTTCACTGGTC
CCAAGGAACGAGGCGCCACGAGGAGCGAGACAGAGGGGAGGGGGAANANAANNCN
Sequence Type genomic DNA
Unitrap ID UNI28970

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11721813..11721943 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020182 (Ddc) NM_016672 dopa decarboxylase Gene [Source:MGI (curated);Acc:Ddc-001]


Sequence tag IST10063C1BBF1
Sequence
ACTGGGGGAGAATAACTTATCACATCCATTCCTCTGTCCCCAAAGGCCTGTCCCTTCTAGGAAATTGTCTGTCTCTGCTT
GTATATGAAAATTCTGATGCCCTCATGTTTATGAAAGGGCCTCATGATGTACTTTTCANAGCTTATCCCTGTTGTTAGGC
AATGCATGATGGTGTTTGCTTACAAAGACACCTGAATTCGTTTCTGAGTTTCCTACNACCGACCGTTANAACNTTANATN
AACAAANANNGCAGTCCCCTTTCGGATGTAANCCTGCNNCCNCNTGNNNCCNTNCATTCAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10063C1HMF1
Sequence
ACTGGGGGAGAATAACTTATCACATCCATTCCTCTGTCCCCAAAGGCCTGTCCCTTCTAGGAAATTGTCTGTCTCTGCTT
GTATATGAAAATTCTGATGCCCTCATGTTTATGAAAGGGCCTCATGATGTACTTTTCAGAGCTTATCCCTGTTGTTAGGC
AATGCATGATGGTGTTTGCTTACNAAGACACCTGAATTCGTTTCTGAGTTTCCTACNACCGACCGTTANAACATTNGATA
ANCANAGAAGGCNNTCCCCTTTCNGATGTAANCCTGCANCCCCNTNANNCCNNNCATTCNNAAAANNAACNANATNTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020182


For any suggestions or comments, please send an email to unitrap@crg.es