Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14518C6
Clone ID IST14518C6
Vector VICTR74
Project tigm

Sequence tag IST14518C6HMR1
Sequence
AGCCCTAGCTGTCCTGGAACTTGCTAATGTANACCAGGCTGGN
Sequence Type genomic DNA
Unitrap ID UNI7213

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104658406..104658447 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070372 (Capza1) NM_009797 capping protein (actin filament) muscle Z-line, alpha 1 Gene [Source:MGI (curated);Acc:Capza1-001]


Sequence tag IST14518C6BBF1
Sequence
ACCTTTCTTACTCTCTAGCCCTCCTTCTCTCTCTCTCTCTCTTCCCCCTTCTCTCCACGTGGCCTTGGCTGGTGGTCTCT
CTCTTTCTACCTTCTCTCTCTCTGCCTTTCTACAATAAAGCTCTAAAACCACAAACAAACCAACCAACCTAAAATATGTA
NTTCTCTTGAANGCNNGTANATTTCTGTGANTTGAAAAACANCCNGGGTTACAAAATATAAACAAAGGGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104658503..104658738 220
 
EST/CDNA Est Name
  AI117733.1 - BY073157.1 - BY106389.1 - AA139812.1 - AA096789.1 - AA498999.1 - BY142665.1 - BY146690.1 - BY010201.1 - BY320926.1 - BY334792.1 - BY782362.1 - BY320900.1 - BY122217.1 - BY049421.1 - BY782874.1 - BY145327.1 - BY791490.1 - BY102367.1 - BY322003


Sequence tag IST14518C6HMF2
Sequence
AAGTCACTGCTCTAGTTTCTCATCACACAGACACCTTAGCAAACAGAGAGACAGAGACACACCCTAGCAAAGAAAACTGA
AAGGTGAAGTGGTATGTCCAGGTTCCCACATGTGTAATAGTCAGATGGGAATATGGGAATTCTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3424442..3424589 148
NO GENE  

 
Come back to gene AI117733.1 - BY073157.1 - BY106389.1 - AA139812.1 - AA096789.1 - AA498999.1 - BY142665.1 - BY146690.1 - BY010201.1 - BY320926.1 - BY334792.1 - BY782362.1 - BY320900.1 - BY122217.1 - BY049421.1 - BY782874.1 - BY145327.1 - BY791490.1 - BY102367.1 - BY322003


For any suggestions or comments, please send an email to unitrap@crg.es