Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13201H7
Clone ID IST13201H7
Vector VICTR74
Project tigm

Sequence tag IST13201H7HMR1
Sequence
AGAACAATCTTNANNCNGTAAAATCATGAGGAAGGATAAAGGAGGANNNGTGATAGTTTTGTGATAGCATTTCAGCATCA
CAGCACAACCACACTGATGAATTTCAGAGGAAGGTGCTCTGGGAGCTTCTGGGGAGCACTAGATGTCTTGGGATGTATCT
CCTGTGGACAAGGGGACCTGTTACACACAGCTGGCTGCCAGTGTTCTGAAAGCTGGGCAGAGGAAGTGGGCAGTGGGTGG
CTGCTGTTGGCTAAAAACACTTCTGCTTAATCCCTTGGCTTTCAGCCTTGAACTTCACTCTGCTTGGTCTGGAGTTACTC
CACGTTAGTGTTTCCAGGAATAAGTCATGAGAGGGTAGGAATGGAGTCCTAGAAAGCCTAGCTGTACCCTTATACAGGCT
GACCCTCTTAGCCTCTTNNACACTGACCTTGGGTAATTCANGTCCTTANTCTTTCTGGGCTTTTGTGANTGGCCCTAAAN
AGTTGCTTCCTTNACCNTAGNTCTTCATTCCCATTTGTNANCCTGAANNTN
Sequence Type genomic DNA
Unitrap ID UNI27871

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108295377..108295903 491
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011831 (Evi5) NM_007964 ecotropic viral integration site 5 Gene [Source:MGI (curated);Acc:Evi5-001]


Sequence tag IST13201H7BBF1
Sequence
AAAGCACTTGTTTACCAATGCCCCAGTCACAGAAAACCCAAATGCCTATGTCTGCAANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 81198834..81198895 60
NO GENE  

 
Come back to gene ENSMUSG00000011831


For any suggestions or comments, please send an email to unitrap@crg.es