Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D039G03
Clone ID D039G03
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D039G03
Sequence
GGTAGAAGTTGNNNCTGTCGGCGGGCGGGCAGGATTGGGGCACCGAGACCGGCGTGCGGACAGCAGGGATCGCGGGGAGC
GAGGGGTGCGGCATGGAGCTCCGGGCAGTCGGTTTCTGCCTGGCGCTGCTGTGGGGTTGCGCGCTGGCGGCCGCGGCGGC
ACAGGGAAAGGAAG
Sequence Type mRNA
Unitrap ID UNI10230

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140857176..140857349 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006445 (Epha2) NM_010139 Eph receptor A2 Gene [Source:MGI (curated);Acc:Epha2-001]


SPLK-Sequence tag 5SD039G03
Sequence
GATCTCGGCTGGGGCGCGCAGGGCTCGGAGGCCGCGGAAAGGGGG
Sequence Type genomic DNA
Unitrap ID UNI10230

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140857562..140857606 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006445 (Epha2) NM_010139 Eph receptor A2 Gene [Source:MGI (curated);Acc:Epha2-001]


SPLK-Sequence tag 3SD039G03
Sequence
GGCGCTCTCGGTCCCTCAGAGGAAAGGACGCTCAGTAGGGTTTTCCCGGCGATCAGCCTCTTAGTAACCCGAGTTCACTT
AACTCATAATCTGCCCCGATTTCTCGCGGAAGGCATTTGGATGCAGGCCCTGCTTTTTGGGGAGGGGTCCTCTCGGTGCC
CTGCACCAAGCAAAAGAGTCTCTCTACGCCCCATCCGATTTTTCACTGGGGTCCTTTGGGCCAGCATTGGGAGCGCCTGG
GGTCAGCCCCGGCCACTCACACCTTCCCTCCTTCCCAAGCTGCCCTCCCAGGTTCGGGAGACAGGTTAAGGGCTGGGAGC
GAGTACAGGAAGTCCCAAAGTCAAGTGTTCTGAGCAAGGGGTGACTCAGAAGGAGGAAATGCGGCAGGTGGGGTTGCGGC
TTCCCGCGGTGTGGAGCCGTCATCTCGGGGCCACGGGGAGCCCAGGCACCTGGAGGTGGGGGAGTGAATCACCTGCCCCC
GCCCCAGCGTCTTGGAGCCACGCAAGGTGAGGGGGCCCGCACAGGTTGCCTTTGCTCAAGGCCGCAGCCGGGGGTGTGCT
TGGGGGCGTTGTCCCTCAGCTAGGGTCTCCGAGAGGGTGGGAATTCCTGCCCTGCCCTTGGCCGAGG
Sequence Type genomic DNA
Unitrap ID UNI10230

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140857667..140858293 625
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006445 (Epha2) NM_010139 Eph receptor A2 Gene [Source:MGI (curated);Acc:Epha2-001]

 
Come back to gene ENSMUSG00000006445


For any suggestions or comments, please send an email to unitrap@crg.es