Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15100F4
Clone ID IST15100F4
Vector VICTR80
Project tigm

Sequence tag IST15100F4HMF1
Sequence
GTTAAACACCATATGGTTCTTAAAAGCCTTCTGAACGTTCTAGAAGCACTTTCTAAAACTGAGCCTTAACTTAGCAGGTC
ATTTAGTATGACAGAGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI20682

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96627780..96627879 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040433 (Zbtb38) NM_175537 zinc finger and BTB domain containing 38 Gene [Source:MGI Symbol;Acc:MGI:2442866]


Sequence tag IST15100F4HMR1
Sequence
NANTTGTATCTNANTTNACCTTTGCTTTCTGATCCTCACCGCTGGCCTGACCTGAANCATGCTGGCTCCTAAGACCTTTC
TTAGCCTATTAGGATGATAGAGAAAACAGTTATATCANTAAAGCCATGACAGAGCCCATGCGCACTGTGCTTTAGGCATT
CCANACCAAGACTGTTGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96627880..96628056 165
NO GENE  


Sequence tag IST15100F4BBF1
Sequence
NTTNNACNCNNTATGGTTCTTAAAANCCTTCTGAACGTTCNANAANCACTTTCTAAAACTGANCCTTANCTTANCANGTC
ATTTANTATGACANAGGTGGTCTGGCTGGCCNCNNNNACCTCACTGGTTTTGTGAAGCANCCTGCTTCANGACAAGCTTG
TTCTANTTGTTTGTTGTANAGACCTAACTGCCTGTCATGGGTGGAAGGAANAGACACTTTGGCAATTTGGTTCGCATCTT
GGTATATTTGTTGAGTATTCTCTANAGAACTAACACTGTTTTCANCCNNGCNGAATGGAATATGACAGGGCCCCCATGGG
GCTCTGTCNNNTTCCCACNNAAGGCTANATNANGATATGGACAGGCGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040433


For any suggestions or comments, please send an email to unitrap@crg.es