Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P099F11
Clone ID P099F11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P099F11
Sequence
ACATCTACATCCAAGCGGAGGGGCGAGCATCNNNATCGNNNCATAACCTCGTATAGTACACATTATACAAACTTATCGAA
TTTCTGCGCGAGGCTAGCACTAGGAAACGGCCCTTTCAGGAGCCTACTCCCGGAGGACATGCAGAAGAGAGAATGAGCCA
GAGGGACACGCTGGTGCATCTGTTTCCGGGGG
Sequence Type mRNA
Unitrap ID UNI10738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97011330..97150910 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]


SPLK-Sequence tag 5SP099F11
Sequence
AATCTGTGCTTTTAAAGAGTCTCCTGGTTACATTGAGCTTGAATTATTCAACTGTGCTGCTTATTCAAGAGGTTGGTAAA
AAGTANNAACGTAGTTGACCNNNTGGCATGCCAGAAATTTTCTCTTATGTACATAAGCAAATACAAACAGCTCCTTAGAG
GTGGGTAAACTTACTAG
Sequence Type genomic DNA
Unitrap ID UNI10738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97007341..97007516 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]


SPLK-Sequence tag 3SP099F11
Sequence
AAAAGTAGAAGATTCTAATTGTCTTATAAAGCTGTTGAGTTAAACAAGGCTGTAGATGCATAGATGCATAGAATATATTT
ATTTTCATCTTATTTCTCTAAGTGATCTTGGCTATTTTACTCTGCTG
Sequence Type genomic DNA
Unitrap ID UNI10738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97007205..97007332 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]

 
Come back to gene ENSMUSG00000032449


For any suggestions or comments, please send an email to unitrap@crg.es