Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11935D5
Clone ID IST11935D5
Vector VICTR76
Project tigm

Sequence tag IST11935D5BBF1
Sequence
CACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCCATAACAAGATCT
GTCG
Sequence Type genomic DNA
Unitrap ID UNI9754 UNI30629 UNI31200 UNI31201

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 96248540..96248620 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 73376055..73376135 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52985723..52985803 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035181 (Heatr5a) NM_177171 HEAT repeat containing 5A Gene [Source:MGI Symbol;Acc:MGI:2444133]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 32517605..32517685 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020272 (Stk10) NM_009288 serine/threonine kinase 10 Gene [Source:MGI (curated);Acc:Stk10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109866096..109866176 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 42311772..42311852 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61181399..61181479 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020085 (Aifm2) NM_001039194 apoptosis-inducing factor, mitochondrion-associated 2 Gene [Source:MGI Symbol;Acc:MGI:1918611]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 64829273..64829353 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 121025375..121025455 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 86425333..86425413 79
NO GENE  


Sequence tag IST11935D5HMF2
Sequence
CACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCCATAACAAGATCT
GACTCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACATACATATAATAAATAAATAAATCTTTAAAAAAAAAAAA
AATGNNNAAATTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 96248540..96248701 160
NO GENE  

 
Come back to gene ENSMUSG00000020085


For any suggestions or comments, please send an email to unitrap@crg.es