Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14440E1
Clone ID IST14440E1
Vector VICTR74
Project tigm

Sequence tag IST14440E1HMR1
Sequence
CAACCNAACAAACAAAAAGAGTAGACTAGATTTTCTGTTATTGTATTCAAGTTTTAGAGGTTAGTGTTTTACATGAAGGT
ATGTGATCTATCTTGAGCTAACTTTTTAAGAGACTATGAATTTACCTTGGATATATTAAAGTCTCTGCTGGATCTGAACT
ATTATTTAGATCATTAAATAATAAATCTAAAACAAAAAGCAAAGCTAAAACCCAGTTTATCAGCCCCTTGCAACTGTATT
GTCACTCTTTAAAACTGTTCATGGCN
Sequence Type genomic DNA
Unitrap ID UNI1113

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41514162..41514426 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019813 (2410017P07Rik) NM_026643 RIKEN cDNA 2410017P07 gene Gene [Source:MGI Symbol;Acc:MGI:1915511]


Sequence tag IST14440E1HMF1
Sequence
GGTTGGTTTTGGTTTTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGAC
CTCAAACTCAGAAATCCTCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGTGCCNCCNCNCCCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41514422..41514571 144
NO GENE  

 
Come back to gene ENSMUSG00000019813


For any suggestions or comments, please send an email to unitrap@crg.es