Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14655F1
Clone ID IST14655F1
Vector VICTR74
Project tigm

Sequence tag IST14655F1HMR1
Sequence
TACATTGGGACAATTATGTTTATGTGATTCATCTAATAGATTATGATGTAAAAACTATATTCATCTTAAAATGTTTTCAC
CCTGTAGCTTGAGTACTGGGATTATAAGTATGAGTTGATGCTGTACCTGTTTAGTTTTAAAAGAGGTCATTAAGTCANAA
CCTTTAATTTTGCTCACTTGACATGGACTACCATGATGCATGTGGTANAACTTTTGGTTCACAGCCATTGAAATCCCCTA
CACAATGTTTTCCANAAACCCCTTATGAATGCTCTTGAATGGAGACTTTATTTCAAATAAAAGCTGTGTTTCC
Sequence Type genomic DNA
Unitrap ID UNI14999

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 68839684..68839995 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034317 (Trim59) NM_025863 tripartite motif-containing 59 Gene [Source:MGI (curated);Acc:Trim59-001]


Sequence tag IST14655F1HMF1
Sequence
GTACGTTTCGTATAGTTTTCATATAAAAACAAGGCTAAAATACAAAATCAAAATATGTACTTGATTTGCTTTGTGGTGCT
AGAGCCAGCAGTCCAGACACTTTCTGATGGGTTTTTGAGACCTCACTGATATCAAGGATGAATTAAACTCAAGTGTACTA
GACAGTTTATCCACAAGCAGCAAGCAGTGCTACTTGGGATGACTGCTCCTAAACCTATGAATAGCCTTGACCCCAAAAAA
AGGTTTAAACAATCCTGGCCTANATTTTTAAAACAACTTATAAATCCTCTCCATCTGTGCATTGGAAAGCTTCAAATCAT
CAAAATAGGCTTGTGGACCTCAAGGATCTTGTCATTTGTTTAAAAATCTTATATCTACATATACAAAGAACTGCCAAGTT
AGCCNCTATAACATGTAACAGTTAAAGAAAAAGACTTATNNATCNNAATAAAACATTNACTAGCAAGCCAATAAAANCAG
GGNNANGNATNAATATTCNACCCAAAAGTTGTCATTTTCTAATTTGATTTTANTCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 68839993..68840529 507
 
EST/CDNA Est Name
  BE447922.1 - BF785208.1

 
Come back to gene BE447922.1 - BF785208.1


For any suggestions or comments, please send an email to unitrap@crg.es