Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12685E12
Clone ID IST12685E12
Vector VICTR76
Project tigm

Sequence tag IST12685E12BBF1
Sequence
AACATGAACTTAGAAAACAAAGAGTAGAAGGACCACCAAACAATACTGAAAGCTGTCATGACTGTTGAAACAATGAGTCA
TCTAACATTGTGTTTAACTCTAAATTCAAGGCCCAGAAAAGACTGCAATTAAAAATAATCTCTGTAGCTTAGTAGTGTGA
CTTAGAATGCAGAGATAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI27289

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 41497253..41497434 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059834 (Sclt1) NM_001081411 sodium channel and clathrin linker 1 Gene [Source:MGI Symbol;Acc:MGI:1914411]

 
Come back to gene ENSMUSG00000059834


For any suggestions or comments, please send an email to unitrap@crg.es