Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14250H10
Clone ID IST14250H10
Vector VICTR74
Project tigm

Sequence tag IST14250H10BBF1
Sequence
TGAGCTGTGACAAGCAACAGTTAGGCAGCTTTAAGAGGGGGTCCTCTCCCCAGTGTGGCTTCCCTCTGCAGTGTTAAAGT
TGGGGGTAGGACTAGGCAGAGAAAATGAACCTAGGCTACTGTGTGAGCCACTCACTCTCCATGCCTAGAATGTCCTTGGG
ACGCTTATGTTCCTGTAACCCTGAACACGGCAAAAGTACAAGACAGGGATGAGCCAGGTCTGATGAGTGACTCATCGAGA
GGGGGTGGGAGGGAGGTNNNGGGTGTNNTGACN
Sequence Type genomic DNA
Unitrap ID UNI30506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155070920..155071191 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042202 (A530082C11Rik) NM_177186 RIKEN cDNA A530082C11 gene Gene [Source:MGI Symbol;Acc:MGI:2444240]


Sequence tag IST14250H10HMR1
Sequence
CTCAAATGGGTCATTACTGTGTGTCGAGGCTATTTCTAACCNCTGCTAGTTCCACCTCCCCAACCCCCGCACAACACANC
TGGTCTANAAAGAAAGATACTATCTCAAGGTGGACAAGCAAGTTATGGACGCCCTGACTGTCCTCCTGCCTGAACTGTAA
GTCANCATTCCAGTGAATACTGTCTGGGGCTGATCTTCCATCCCAGTGGAAAGCTTTAAGGCCAGCCACTGGACTAATGC
CCGAGGCCCTTGGGGGAACTGAATCCACCTTCCCGTCCCTCACCCATAGCCTCCCCTCCANCATTCCAAATAAACACACA
ANACAGTGGTTTTGGTCTGAGAGTGATGGACATTTANATGTTGGCNACTGACCNGTGCCTCACANGGAACGGGCAGAGCA
AAGACNGAGAGGTANGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155070506..155070923 394
 
EST/CDNA Est Name
  AW123941.1 - BM221664.2 - BX629840.1 - AI844938.1 - AW045231.1 - AI839682.1 - BQ552986.1

 
Come back to gene AW123941.1 - BM221664.2 - BX629840.1 - AI844938.1 - AW045231.1 - AI839682.1 - BQ552986.1


For any suggestions or comments, please send an email to unitrap@crg.es