Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14705D9
Clone ID IST14705D9
Vector VICTR76
Project tigm

Sequence tag IST14705D9BBF1
Sequence
GGTTGGTGTAAGCATCTCTTGCAAGCCGCAGATTTTCTGAGTGCTTGGAATTCGAGTTCCTCGCTATTTTCTTTCACTGA
TTTTGTTTACCGATCCAGGAATCTTTATATCTATCTCCCCGTTTAAAGTATTCTCCCTTACCCCATCCGTCCCTTCAAAA
AGAAAAAGAAAAAGGGAAAAGGATTTTAAAAAAAGAGAGAGAGAGAAATAATTGGATGCTACAAGGACACAGCGTGGCAA
TCCTCCGANCTGCTGCAACCTCGAGGGGACCCGGGAAGCCAGTGTGGGGGAGGGGCGCNCCTANACAGCTTGCACCCACT
CTTTGATNTTGCGTANCCCGGGTCCTCTANNCTGGACCGGGAANANCTG
Sequence Type genomic DNA
Unitrap ID UNI31211

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120091870..120092237 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043993 (2900052L18Rik) RIKEN cDNA 2900052L18 gene Gene [Source:MGI Symbol;Acc:MGI:1924085]


Sequence tag IST14705D9HMF1
Sequence
GGTTGGTGTAAGCATCTCTTGCAAGCCGCAGATTTTCTGAGTGCTTGGAATTCGAGTTTCTCGCTATTTTCTTTCACTGA
TTTTGTTTACCGATCCAGGAATCTTTATATCTATCTCCCCGTTTAAAGTATTCTCCCTTACCCCATCCGTCCCTTCAAAA
AGAAAAAGAAAAAGGGAAAAGGATTTTAAAAAAAGAGAGAGAGAGAAATAATTGGATGCTACAAGGACACAGCGTGGCAA
TCCTCCGANCTGCTGCAACCTCGAGGGGACCCGGGAANCCAGTGTGGGGGANGGGN
Sequence Type genomic DNA
Unitrap ID UNI31211

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120091943..120092237 287
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043993 (2900052L18Rik) RIKEN cDNA 2900052L18 gene Gene [Source:MGI Symbol;Acc:MGI:1924085]

 
Come back to gene ENSMUSG00000043993


For any suggestions or comments, please send an email to unitrap@crg.es