Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14413H10
Clone ID IST14413H10
Vector VICTR74
Project tigm

Sequence tag IST14413H10HMF2
Sequence
CAGTGCCNTGGAGGCTGAGGCAGGACGATGCTGCCCGGACTCACTGGN
Sequence Type genomic DNA
Unitrap ID UNI19521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150190039..150190085 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052281 (OTTMUSG00000018795) predicted gene, OTTMUSG00000018795 Gene [Source:MGI Symbol;Acc:MGI:3705185]


Sequence tag IST14413H10BBF1
Sequence
CAACCCACGACAAGGACCAGGAAGGAGTTCAAGACCCGGGCTCTCACAAGATAAAAAGGGAAGAGGTGCAGGGCTGCAGC
TCAGCTGGGAAACCTCTGTAAACCTCTACTCTATCTGAGGACTGGAGTTCCGATCCCAGCGCCCACATCTGGAAACTCAA
AAGCACCTGTAACCAGAGCTTCAAGGGATGAGACCCCACTTTCTGGACATCCATGGATAAAAGTCAAAATAAACCATTCA
TTTAAAAGTNNNNNNTTTTNNNNCGTGGCTCAGGGGTGGAGTCCTGCTGAGAATCCCCCAGTGAGGGGCTGTGGGCATGG
CTCAGTCTCAGANCACCTATCTAGCANGATTGAGGTCCTGGGTTTCATCCCTANAGCTAATTTTTTTTAAATGCNGGGAG
GANCTGCAAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74851589..74851998 380
NO GENE  

 
Come back to gene ENSMUSG00000052281


For any suggestions or comments, please send an email to unitrap@crg.es