Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14386G7
Clone ID IST14386G7
Vector VICTR74
Project tigm

Sequence tag IST14386G7BBF1
Sequence
ATTCTTTCCACAAAACGCTTCCTTCCCCCCTGCGTTTCTAGCCAAAGATACACCTTTTCCTGTTTTTCCTGGATTAGTTT
CCATAACAACACATTGAACCCCATTTTAAATACCATATAGCTTTTCTGTTCTTTCTTCTTTCTTTTTCTTTCTTTCTTTC
TTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCCTTCCTTCCTTCCTTCCTTCCTTTTTTT
TTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66543361..66543606 246
 
EST/CDNA Est Name
  BY168997.1 - BY179427.1 - BF470037.1 - BY336090.1 - BY329778.1 - BY009720.1 - CJ179997.1 - BY330796.1 - BY150448.1


Sequence tag IST14386G7HMR1
Sequence
GAATTAACTGTCGTGAAGCAAAGACACTTTGCAGAAGTTACATGTAGATTCTCTGCACAAACTAACAATGAATCGGAAAG
ATGGCN
Sequence Type genomic DNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66543280..66543364 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]


Sequence tag IST14386G7HMF1
Sequence
ATTCTTTCCACAAAACGCTTCCTTCCCCCCTGCGTTTCTAGCCAAAGATACACCTTTTCCTGTTTTTCCTGGATTAGTTT
CCATAACAACACATTGAACCCCATTTTAAATACCATATAGCTTTTCTGTTCTTTCTTCTTTCTTTTTCTTTCTTTCTTTC
TTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCCTTCCTTCCTTCCTTCCTTCCTTTTTTT
TTTTTNNNTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66543361..66543605 245
 
EST/CDNA Est Name
  BY168997.1 - BY179427.1 - BF470037.1 - BY336090.1 - BY329778.1 - BY009720.1 - BY330796.1 - BY150448.1

 
Come back to gene BY168997.1 - BY179427.1 - BF470037.1 - BY336090.1 - BY329778.1 - BY009720.1 - BY330796.1 - BY150448.1


For any suggestions or comments, please send an email to unitrap@crg.es