Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14683A6
Clone ID IST14683A6
Vector VICTR74
Project tigm

Sequence tag IST14683A6HMR1
Sequence
CANANATATGACTGTTNNCTGAGTGCTTCCTTACTTGCTGGCAGAGTGTTTCACTTGTATTTACCTTGTCCTAACCTGAA
CTCTAACCTAACTCTCTTTCTTTAGAAAGTTGTTTTCAGACTTATTTTTATTTTTTTAATTTTGTAATATATTTATGTAC
AGAAAGCTTAGTGTACATTTAACCCAATTTANTGGCAAGTTCTTTATCCTTTGCCTTN
Sequence Type genomic DNA
Unitrap ID UNI31220

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 34246091..34246307 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021936 (Mapk8) NM_016700 mitogen-activated protein kinase 8 Gene [Source:MGI (curated);Acc:Mapk8-001]

 
Come back to gene ENSMUSG00000021936


For any suggestions or comments, please send an email to unitrap@crg.es