Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10885F5
Clone ID IST10885F5
Vector VICTR76
Project tigm

Sequence tag IST10885F5HMR1
Sequence
TTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTTTGCAGACCAGG
Sequence Type genomic DNA
Unitrap ID UNI14335 UNI30748 UNI31225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35910439..35910485 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 8393451..8393497 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13821507..13821553 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 28456394..28456440 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 39527433..39527479 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 45300985..45301031 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22794446..22794492 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107357087..107357133 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010066 (Cacna2d2) NP_064659 calcium channel, voltage-dependent, alpha 2/delta subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1929813]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 36516911..36516957 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12856305..12856351 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 12269324..12269370 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 93997794..93997840 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045095 (Magi1) NM_010367 membrane associated guanylate kinase, WW and PDZ domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1203522]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52788648..52788694 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53760465..53760511 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 32681399..32681445 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33004317..33004363 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027674 (Pex2) NM_021483 peroxisomal biogenesis factor 5-like Gene [Source:MGI (curated);Acc:Pex2-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7564237..7564283 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 57266691..57266737 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 17225006..17225052 47
NO GENE  

 
Come back to gene ENSMUSG00000027674


For any suggestions or comments, please send an email to unitrap@crg.es