Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12793C1
Clone ID IST12793C1
Vector VICTR76
Project tigm

Sequence tag IST12793C1HMF1
Sequence
CACACAAAAGGGAGTTGGGAANAGTCGGGGAACAGGGATGTAATCTTGTGTGGAACACCACAAAAACAAAACAAATGGTA
ATTACCATTTTGATCAAAGAACTAATACTCAGGTTTGGGCCCTCCGCCCACCTANAGTCAGGCAAGCATACANAGTTTAT
ATANAGAGGATCTGTATCGCTCCCCACATTGNCNNGN
Sequence Type genomic DNA
Unitrap ID UNI31228

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96044023..96044213 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041440 (Gk5) NP_796326 glycerol kinase 5 (putative) Gene [Source:MGI (curated);Acc:Gk5-001]


Sequence tag IST12793C1BBF1
Sequence
TTTGGGGGCNNNNCNGGGANCGGNAGACCCCTGCCCANGGACCACCGACCCNCCACCGGGAGGTNANCTGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000041440


For any suggestions or comments, please send an email to unitrap@crg.es