Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13902C9
Clone ID IST13902C9
Vector VICTR74
Project tigm

Sequence tag IST13902C9HMF2
Sequence
GTTTTGTTTTGTTTGTGAGAGAGGAATCCATCCCATGGATTGGCTTGGTTAGTTTGACAGTTTTACCAAAGAAGAGCAAA
TCTATAATACTGAGTGGATTTTGCTGAGAATCCAAAAGCAAACCGAATTAAGGAGGAACTGCTACTTGGCC
Sequence Type genomic DNA
Unitrap ID UNI31229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55222582..55222731 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022179 (4931414P19Rik) NM_028890 RIKEN cDNA 4931414P19 gene Gene [Source:MGI Symbol;Acc:MGI:1921609]


Sequence tag IST13902C9BBF1
Sequence
CTAAAACCAGGCGTTCCAAGGGANAGGANAGTGCGGATCGCCGCCGTGAGAGAGGTGAGTGGAANAGCGCGTTCTATGCA
CACAGTGGCACGCGGGGCACCACGCAAAACTGAAAGGAACCCTTCTCACACAAGGCTGCGGGGGCTTGCTTCAGGGGATC
T
Sequence Type genomic DNA
Unitrap ID UNI15335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56442931..56443090 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001228 (Uhrf1) NM_010931 ubiquitin-like, containing PHD and RING finger domains, 1 Gene [Source:MGI (curated);Acc:Uhrf1-002]

 
Come back to gene ENSMUSG00000001228


For any suggestions or comments, please send an email to unitrap@crg.es