Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14157D4
Clone ID IST14157D4
Vector VICTR74
Project tigm

Sequence tag IST14157D4HMR1
Sequence
AATCCCAGGTCTTTGGGCTTCTTGGAGCCTGTGAGCTGAGCTATAAATGTTTGTGTTTTCCCCTGGGACCTGTGTATGTA
TATACATGTATGTGAGTTCCTGTGTGTGGAGGCCAGAGGTCC
Sequence Type genomic DNA
Unitrap ID UNI16274

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24338549..24338669 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036473 (Tbc1d24) NM_173186 TBC1 domain family, member 24 Gene [Source:MGI Symbol;Acc:MGI:2443456]

 
Come back to gene ENSMUSG00000036473


For any suggestions or comments, please send an email to unitrap@crg.es