Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13064A5
Clone ID IST13064A5
Vector VICTR76
Project tigm

Sequence tag IST13064A5BBF1
Sequence
GTCTGTTGGTACTCTGTCTGTACTCCACCCCCACATTTCTCTGGCAATAGCCAGGTAGTCCTGGCTNACTATAAAAGGGG
CTGATGCATCCCCTCCATCTTGCTCCCTTGCTCCCCTCTCTCCCCATTCCCTTTCCCCTTCTCTCCACGTGGTCATGGCT
GGCCTCTACTTCTCTACTTCTCTCTGCCTTTCTCTGCTTCTACTACTCTCTTTTTTGTTTGTTTTGTTTTTCNANACAGG
GTTTCTCTGTGTANCCCTGGCTGTCCTGGAACTCACTTTGTANACCANGCTGGCCTCAAACTCANAAATCCGCCTGCCTC
TGTCTCCCAAGTGCTGGGGTTAAAGGCGAGCGCCACCACGCCCGGCTTCTACTACTCTCTTAACTCCCCTCCCCATGCCC
TAAATAAACTCTGTTCTATACTATACCGACCTTNNACCTTCNNNTGGCTGGTCCCTCNNGNANGN
Sequence Type genomic DNA
Unitrap ID UNI31231

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20212717..20213173 433
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002983 (Relb) NM_009046 avian reticuloendotheliosis viral (v-rel) oncogene related B Gene [Source:MGI (curated);Acc:Relb-001]

 
Come back to gene ENSMUSG00000002983


For any suggestions or comments, please send an email to unitrap@crg.es