Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14251G7
Clone ID IST14251G7
Vector VICTR74
Project tigm

Sequence tag IST14251G7HMR1
Sequence
GCCTAAACAGCTTCAACCCCATGGGAATGATACCTGGAATTCCCTANACAAATACATTGCTTTTCTAAAGATTAAGCANC
ATTTACACAGTCTAATAAAACCTGTTGCTCATCAGATGTTCTGCAAAGCTAGAGAAAGGGTGAGGTTTCCTACATGCTAA
NAAAGCATTCTTCTNATGAATTATNTCCTGGCCCTTTTTTTTATTATAAGACAGGGACCTAACTAANTTC
Sequence Type genomic DNA
Unitrap ID UNI24079

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 104492308..104492536 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044952 (Kctd21) NM_001039039 potassium channel tetramerisation domain containing 21 Gene [Source:MGI (curated);Acc:Kctd21-001]


Sequence tag IST14251G7HMF1
Sequence
NGCNNNNNANNAAANGNNNNACCNNGNGNNANGANAANCTGTNNCANCAGGCANCCNTNNNNNCNNCNCTTTTCCCTGTC
TATNNNANGCCNNTTCNNCTGCCGAANCTCCNGGNATANCCTTTANCANCTNANANTTTNNNCCNTTGAATAAACCCTGA
CTTCCTTCTNNNCNNNACCTTGTCTCACANTATTGGCTTCNGANAGGTGAACACGCTCANTCNTGGAATANAANCANCAC
ANGCACCAGACATGATGGTGTATGCCTGCAATCCCAGCAGCTCGGAAGTGGAAGANTACTCTTTGACACCAGCTGTTCTA
TGGCAAGTTCCTCTGGGATAAACAATCCATCTGGAANGAANGTCTAGACTGGAGGGAAGCTCACTAAGANGCNGGATGTT
AAAACTGANGTGAGCACNANNNTGTTCTANNGANANNNGAAATGCTCTATCCTGCNNGNNANCTTGCANNGCCCCCAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14251G7BBF2
Sequence
CAATAAAACAAATTCTGCAGCANAGGGTTTTCTGCATTGAAGGCAACCACAGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 8419606..8419662 55
NO GENE  

 
Come back to gene ENSMUSG00000044952


For any suggestions or comments, please send an email to unitrap@crg.es