Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14638B2
Clone ID IST14638B2
Vector VICTR74
Project tigm

Sequence tag IST14638B2HMR1
Sequence
TTCATGCTCGCACAAAAAGTACCTTACCAAGTGAGCCACTTCTTTAAGTCACCATGTAGCCGGTTCCATCTCTGGTTTAT
GTATTTTACAGATCATTTCACTTAAAATAATACTTTCCAGTAATTTAAAGCAAGTTTTCTTACAAAGTCCAGGTAATAGA
GTGAATCTCACTGTTGTTTTGGAGATGAGTAATAAATAATTNNAATTCCTTANTTCCCCCCCCCCCCN
Sequence Type genomic DNA
Unitrap ID UNI31239

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 60065446..60065672 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026977 (March7) NM_020575 membrane-associated ring finger (C3HC4) 7 Gene [Source:MGI (curated);Acc:March7-003]


Sequence tag IST14638B2HMF2
Sequence
ATGAAAACCTAATCTCAAGTGCATGCCATCAGATATTTCTTTTTCATTTTAAAACCCACATCTCTTGCATGCTTCAAGGA
GACCTATTCTGAGAATCAGAGGGCTGGCTAGAGGGTGGTGGAGAAAACAGGCAAGGCTGACCCTGGAGACTTAGTGTTCC
ACAGAAGCAGCTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63048095..63048267 169
NO GENE  


Sequence tag IST14638B2BBF1
Sequence
ATGAAAACCTAAGTTCAGTCTCCAGCACTCACAAAAAAGAAAGGGGTTGGGGGACACACCTATAATCCCAGCCTTAGGAA
GGCAGACACAAAGAAACCTTAGAATATGTTGGTGGGAATCTGTAAGCTCCAGATGTAACCAGTAAGGCAAAGTGCAATGC
TGGGAAGAAACCTCTGGTCACACACACCACACACATACATACGCACGCACGCACGCACGCACGCGCGCGCGCACACACAC
GCACACATGCACATACACACACACACATACACACCCCCAATTAAATTCAGTTCATGTAAAATGGGGAACTGAATACTTTC
CACTTTTATAGATTTGTAATTAAGTTTCTAAATTTTCTTCAAAGTATATAACATAGAATAGCCAATCATTAACTACCAGA
TCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 60065048..60065450 403
 
EST/CDNA Est Name
  AA986084.1 - AI043081.1

 
Come back to gene AA986084.1 - AI043081.1


For any suggestions or comments, please send an email to unitrap@crg.es