Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10069H3
Clone ID IST10069H3
Vector VICTR75
Project tigm

Sequence tag IST10069H3BBF1
Sequence
GGTGTATGTGTATCTGTATACCAGAAGACAGCATCAGACAGTTGTGAGCTACCATATGGGTGCTAGGAAGTGGACTCAGG
ACCTTTGGAAGATCAGGGAGTGCTCTTAACCACCGAGCTATTTCTCTGGTCCCCTGGTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTG
Sequence Type genomic DNA
Unitrap ID UNI19146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 42195153..42195320 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038302 (Lace1) NM_145743 lactation elevated 1 Gene [Source:MGI (curated);Acc:Lace1-001]

 
Come back to gene ENSMUSG00000038302


For any suggestions or comments, please send an email to unitrap@crg.es