Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12233E11
Clone ID IST12233E11
Vector VICTR76
Project tigm

Sequence tag IST12233E11BBF1
Sequence
GTTTGTTTGTTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCTA
ACTCAGAG
Sequence Type genomic DNA
Unitrap ID UNI5735 UNI31240

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 34714060..34714146 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 44624871..44624957 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 63533654..63533740 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 60176964..60177050 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110742328..110742414 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26088756..26088842 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031555 (Adam9) NP_031430 a disintegrin and metallopeptidase domain 9 (meltrin gamma) Gene [Source:MGI Symbol;Acc:MGI:105376]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3428900..3428986 85
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38623951..38624037 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063972 (Nr6a1) NM_010264 nuclear receptor subfamily 6, group A, member 1 Gene [Source:MGI (curated);Acc:Nr6a1-001]

 
Come back to gene ENSMUSG00000063972


For any suggestions or comments, please send an email to unitrap@crg.es