Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D048H03
Clone ID D048H03
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D048H03
Sequence
TTGATTCCTGACTGAAGGTGGAAGACTACGCGTTGGGACTAGCCGGGAAGGGCGCAGCCTTGGGCTCACGAGTGGGCAGC
GTCCGAGGAATCGCGCGCGG
Sequence Type mRNA
Unitrap ID UNI10917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89518973..89519072 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027951 (Adar) NM_001038587 adenosine deaminase, RNA-specific Gene [Source:MGI (curated);Acc:Adar-005]


SPLK-Sequence tag 5SD048H03
Sequence
AGTTAGTTCTTGTAGCTTTGAGCAGTCTCAGGAAGGAGGCTGGTCAGAAGATAGACCAGCGTCTAAGCCAGACAAGGACC
CAGCNNGGGGCAGACACCCCTTCTCTTTCTGCTAA
Sequence Type genomic DNA
Unitrap ID UNI30277

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89534870..89534984 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027951 (Adar) NM_001038587 adenosine deaminase, RNA-specific Gene [Source:MGI (curated);Acc:Adar-005]


SPLK-Sequence tag 3SD048H03
Sequence
CCAACATGAGCAACTTTTCTCATGATCCTCTTTGCTTTTTCAACTTCCTGAGAAATTTAAATTATCTCAACTAACCAGCA
GGGGGAAGTCTTTTGCTTTATGGCCAAGAAGGGTGTCTTTCTGTAGCGCACTGGGTAAGCTTCGTGGAATTCTACTTAGC
ACTAAAATGAACTTGTGATGTCGTACATGAGCCCCAGCTGCAACGTTCTGAACAGAAAAACCCAGATTCCGAGGATTCAT
GCTGTCACAGCACTGG
Sequence Type genomic DNA
Unitrap ID UNI30277

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89535016..89535272 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027951 (Adar) NM_001038587 adenosine deaminase, RNA-specific Gene [Source:MGI (curated);Acc:Adar-005]

 
Come back to gene ENSMUSG00000027951


For any suggestions or comments, please send an email to unitrap@crg.es