Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10807E2
Clone ID IST10807E2
Vector VICTR76
Project tigm

Sequence tag IST10807E2BBF1
Sequence
ATTTATTTATTTATTTATTTATTTATTTATTTATTATATGTAAGTACACTTTAGCTGTCCTCAGACACTCCAGAAGAGAG
AATCAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI22153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96476513..96476602 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]


Sequence tag IST10807E2HMF1
Sequence
ATTTATTTATTTATTTATTTATTTATTTATTTATTATATGTAAGTACACTTTAGCTGTCCTCAGACACTCCANAAGAGAG
AATCAGATCTCATTACAGATGGCTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCTTGACCTTCGGAAGAGCAGTCG
GGTGCTCTTACCCACTGAGCCATCTCACCAGCCTGAGAGAATGTCTTTTCTCAAATTANACTTGCCAAAGACTTTAAAAT
AGGTTGTCTGGCTTCAGCTATGGGTTGTTCCTCANGAAACCCTATTATCATAACCCCCAAGATGATGTCCCCCGCTTACC
ACACAGAGCCTTTTGCAGATCCTGTGACAGCTTTTTTTGGAAACCCCAGAAGCCCAGTTTCCCAGTTATGCNAGCCAATC
ATCTCTTGCTATTCTAATCCNAGTTTTTGCATGANGAAGCTTCCTCTGANGCAAGGATGGAA

Sequence Type genomic DNA
Unitrap ID UNI22153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96476513..96476973 447
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es