Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14849C6
Clone ID IST14849C6
Vector VICTR76
Project tigm

Sequence tag IST14849C6HMR1
Sequence
GATNATATTACAGATGGTTGTGAGCCNCCATGTGGTTGATGGGAACTGAAATCAGAACCTATGGAAATGCAGCCACTTCT
CTTAACTACTGAGCCATTTCTCCAGCCCATAGATGGTTC
Sequence Type genomic DNA
Unitrap ID UNI6252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154290604..154290721 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]


Sequence tag IST14849C6BBF1
Sequence
ATCTGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTATTCATATACATAATAAATTAAATCTTTAACAAAAAA
AAGTTAACCATCTAGGAAGTCTATCACAGCCAGTCANACTATCTAACAAGCCATTTTTTTTCTTCCTGTAAGCCACTCCT
GATCCTTTATTTATTGATCTGAAGTTGGAGGGAATCAATGCACATACTCTCCACATATCAGGACCTTCTAAACTGGAACT
TGCTANAATATATAACCCACATGTTCAANAAAANAAATCATGAAAGTAANTACACTGGTAAATGCCTCANAANCNAACAA
CTGTGCTCANATCCNAGTGGCTGCAGGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154290255..154290606 330
NO GENE  


Sequence tag IST14849C6HMF1
Sequence
ATCTGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTATTCATATACATAATAAATTAAATCTTTAACAAAAAA
AAGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154290519..154290606 88
NO GENE  

 
Come back to gene ENSMUSG00000038533


For any suggestions or comments, please send an email to unitrap@crg.es