Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11230B3
Clone ID IST11230B3
Vector VICTR76
Project tigm

Sequence tag IST11230B3BBF1
Sequence
ACTCAGCTTGGCTTTGATTGTAAAATGCCTGANCCCTCCCCGANTAAGTAAAAAACACACAAGACCTGCTAAACCTGCCT
CTGGCTTCCTCTTTTCAGCTGACCATGTTCTGGGTCATCCCAGTGGCCCTAAAGTTCACAGAATGCAGTTATCAATACTA
ACAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI10574

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88795049..88795217 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]


Sequence tag IST11230B3HMF2
Sequence
ACTCAGCTTGGCTTTGATTGTAAAATGCCTGANACCCTCCCCGANTAAGTAAAAAACACACAAGACCTGCTAAACCTGCC
TCTGGCTTCCTCTTTTCANCTGACCATGTTCTGGGTCATCCCAGTGGCCCTAAAGTTCACAGAATGCAGTTATCAATACT
AACAGATCTCCTTTCNACCCGCTTCTGGCTTCCTCCCTCCTCTACCTGGATCAATGTGACACTTCCTCCTTTTCCAGGAA
AAAGCCTCTCTCCACTGTGCTGTCTCCCCCAGCAGTTTGGGGGCCATCTCTGTGGAGTTCTGATCTANCCCTTTGACTCA
CTGTATACCAGTTTGCTTTTANTTCGTCTCTGTNNGCGCCATGTGAGACACCTGCAANGANACNCCTTAANTNNNCG
Sequence Type genomic DNA
Unitrap ID UNI10574

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88794828..88795217 368
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es