Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D001B07
Clone ID D001B07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D001B07
Sequence
CGAGATTTATTCCTACGTACCGGGCCGTGCTGCTTATGGCGGCGCTGGAGAAGGGGGCGCTGAGCTGTTGGG
Sequence Type mRNA
Unitrap ID UNI7671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102824522..102824592 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]


SPLK-Sequence tag 5SD001B07
Sequence
GATCTAATACTTGTCCTTGTTTCTTTTCCTCTTAGAACTGGAATGTAAAGAGCTGGTAGTAGTTTGGTTTTGCAGCTGCT
CTGATGTTTACCATCACCATGAGTATTTATAGCAGCTGAGTGGAAAAGCAGAGTATTTGAAGCACAGACGATAGGTTTTC
TTTTTTCATAAAAATAAGTTCTGACTTAAGTGTGACCTTTATAGGAATGATTGGAAGTTGTGGTAAGTTTCCAGCTAATG
AAAACTATGAA
Sequence Type genomic DNA
Unitrap ID UNI7671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102826509..102826759 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]


SPLK-Sequence tag 3SD001B07
Sequence
TTTCTTTCACACCCTCCCTTCAGTCATTCCATTTTTATGTAATGTAAACCTTAGTGGGTTT
Sequence Type genomic DNA
Unitrap ID UNI7671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102826770..102826830 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]

 
Come back to gene ENSMUSG00000068823


For any suggestions or comments, please send an email to unitrap@crg.es