Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10472H11
Clone ID IST10472H11
Vector VICTR76
Project tigm

Sequence tag IST10472H11HMR1
Sequence
NGCTTTGAATACAANTCNCATCTTCCCTTCTTGGCTNACCTCTGCCAGTANGGCTGCANTANCTATGATCANAGCTGCCA
GCAATGGGAGGATTGTTCTATGTTTTGTCCCATATTACTACTAGCGTAAGTCCATTAAGCACTTGAAATGTATTATTTTT
ATACTAACTTTTTATTGAAAATTTCTGAGCTTCACATCATGCACCCCAGTCCCACTCATCTCCCCATCCCTTTGTATCTG
CCCTTGCCACCTCCTTTCCTTCTCCCACAANAAAGTAAAAAGCAAAAAGAATAAAATTTAAAACATAANAAAACATCCGG
TTATGGTANCTGTANTGTGTCACTGTGTGTCCACTCAGCTTTCCTTGCAAATGCTCATTGCCNTGANTCATTGGTGTGGT
TANAGGACCTGGCTTCTGCTNCACN
Sequence Type genomic DNA
Unitrap ID UNI14329

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30449777..30450199 393
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039697 (Ncoa7) NM_172495 nuclear receptor coactivator 7 Gene [Source:MGI Symbol;Acc:MGI:2444847]


Sequence tag IST10472H11BBF1
Sequence
GGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTNACCANCCCGATTTTTATTTATTTATTAATTTATTTTTGAGA
CAGGATCTCACCATGAACCACGTCTGACCCATTCCATTTTTTTCTTCACATTTTTAGTTGTTTTTATTTTTTAATTTTGG
TTTTATTTCAAGACAGGGTTTTGTGTGTGTGTGTGTGTGTGTGTGTGTANTTNTANCNGGTNTNANNCTNNCTCTGTANA
CCANGCTGGACCTNTNNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10472H11HMF1
Sequence
GGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCNTCTCACCAGCCCGATTTTT
Sequence Type genomic DNA
Unitrap ID UNI34897 UNI35414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28527932..28527985 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81908706..81908759 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78467562..78467615 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 19690894..19690947 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28415744..28415797 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004056 (Akt2) NM_007434 thymoma viral proto-oncogene 2 Gene [Source:MGI (curated);Acc:Akt2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 104277536..104277589 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027177 (Hipk3) NM_010434 homeodomain interacting protein kinase 3 Gene [Source:MGI (curated);Acc:Hipk3-001]

 
Come back to gene ENSMUSG00000027177


For any suggestions or comments, please send an email to unitrap@crg.es