Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10619E10
Clone ID IST10619E10
Vector VICTR76
Project tigm

Sequence tag IST10619E10BBF1
Sequence
ATTCTTGGCTGCAATCACCTTTACCCGCTGCGCCATCTCACCAACCCCTCCCCGACACCTTTTCAAGCCCATTTTTCTGT
CCTTGATGTCCTTTTGCCTAGCTCCAAGACCTGTTCTAATTCACATTTGCAAAGCTGTGTAATCCCAGCTCTTCTGGATG
GTGAGACAGGAGGATTGATGTGAATTCAAGGCCAACTGAAGCCAAACATTGNNACCCTGTCTAAATAAACAAAATAAAAC
CCANGCGGAAGCAAAGGCAANCCCTGCCANATGTGGCCTGTGGGGACAGGCACTGACCCTGTGACCTGGCCTGCAAAGAG
TGTCNNATCTG
Sequence Type genomic DNA
Unitrap ID UNI10803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20327286..20327615 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062300 (Pvrl2) NM_008990 poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]

 
Come back to gene ENSMUSG00000062300


For any suggestions or comments, please send an email to unitrap@crg.es