Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D001H07
Clone ID D001H07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D001H07
Sequence
CCTCACCCCNNAATCACCAGCCANNGAACCACCAGCCACCCGCAAACCAAAGATCCCTCTTGTGCTCAGGAGGCTGCAGC
TCCCTCTGGGCCCCAGCTGCAGGTCCTTGNNNCAAAGGAGAAGGCTCCCACGTTCTCAGCGTCTGTCCGGGGGAGGCATC
TGAGCCATCCTGAGCCAGAGCAACAGCACGTGATCCAGAGGTTGCAGCCGGAGCAGGGGAGCCCAAAGAAGTGTGAAGCT
GAAGAGGCAGAGCCGCCAGCTGCCACACAGCCTCAAACCTCAGAGACTCAGATCTCTCATCTGCCAGAATCAGAAAGGAC
TCATCACACTGT
Sequence Type mRNA
Unitrap ID UNI10852

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55281005..55282626 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022185 (Acin1) NM_023190 apoptotic chromatin condensation inducer 1 Gene [Source:MGI Symbol;Acc:MGI:1891824]


SPLK-Sequence tag 5SD001H07
Sequence
GATCTTGGGTCGTCTCAGCAGGAGGAAGGCTCTAACTTAGTGGCCCACGCTCCAAGTGAGCGCCGCAGGCGTTCTTTACT
TAGTGAGACTGGGGAAAGTCCATAGGAACAAAATTCCGTAACCAAAAAAGCTTCCTACAAATACTTGTAGAGGCCTTTTA
ACAGCAGGAAGTACTTTAGAACAGTAGATGTACATTCTGAGGGACGATGATGTGGGAAAGCTGTGCAGGGATCAGCTGAG
GTGGTGCACACCTTTGATCC
Sequence Type genomic DNA
Unitrap ID UNI10852

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55275862..55276121 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022185 (Acin1) NM_023190 apoptotic chromatin condensation inducer 1 Gene [Source:MGI Symbol;Acc:MGI:1891824]


SPLK-Sequence tag 3SD001H07
Sequence
TATNTACCTTTACGCGGCTGTGAGGTGGGTGAAACAGGCTCATCTCGGAGATCAAGGCAGTCTGCTCTACCCAGCAAGCT
CCAGGACAGCTGGGGCTGCATAGTGTCGACACCAGTCTCATTCAGCCACACGTGGTGGCTCACGCCTTAATCCTAGCACT
TGGGAGGCAGAGGCAGAGGCAGGCAGATTTCAGAGTTTGAGGCCAGCCTGGTCTACAGAATGAGTTCCAGGACAGCCGGG
GCTATTCAGAGAAACCCTGTCTCGAAAACCCCAAAAAAAAAAAGTTTTTCCAAAAAGGGTTTTTTGGTTGGGGGGCTTTG
GGGTTAAAGGGCTTGGACAAAAGGGGAAGGATTAAAAGTGCCCAAAACCTGGGGCCCCCCCTTGGGGAAGGGTTGGTGGC
CCTGGACCATCCTCCCCAGGGCGGGGTTTACCACTTAGCCAAAAAAATTGGGAAAATCTTCCAGTTCCAAAACCCCTAAG
GGGCGACCCCAGTTTTTTTCAGCCAAAAATNNNNNTTNNGNNNNNTTGNNTTTNNTTGTNTTTTGGGGGGGCGGGCNGCN
NTGNNNGCNGGNTTTTTTTNTNNGNTNTGGGGNNNNGTGGNTNNTGGCNGNNTNNTNGGGGNTGTNNTNNTGTTGNTNNN
TGTGTGNNTNTTNTGTTTGCNTGTNNGGTGGNGTGGTNGTGTNGTGTNNTNNTTTGTNNGTGTNNGGGTGTTCTTGTNNC
GTTTTTNNTNTNGTGGTTNGTGNTGTTGNNNNNTTTTTGNNGNTGTNGTGTNNTGGNGTNNGGGGNTTGGTNNGGNNTTG
TGTTTTTGTNTNGTTTNGNTGGGNGGTNTTNNNNNNTTTGGTTNNTGTGTGGTTNNGNTGNGTGTTTGTNNTNNNNGNGT
GGGGTTTTTNTGTNNNNNGGNGNTTTNTGNTGGNNTTNGGNGNGGTNNGNNNGGTNGGGTGTGTTTTGNTGGGGGGGGTT
GGNNGGGNGGNGGGGNNGTNNAGNGNTNGGNNNNTGTGNTTNGNTTATTTNTTTTGTGGTTNNTTCGGTCTGGCGGTGGG
TTGGGGGGTTTGCTGTTGTTGTGTGCGTGTTTTTTGGTTTGTTGGGTCGNTTTGGGGGGGTGGGGGTATTGGGGTTTGTG
TAGTGGGTTGTCGGGTGTCTTTGGTGGTTGTGTCGTGTGTCGGCTTTGCGTGATTGATTGCATGTTATGCTTGTTTCTTG
TAGNTTTCATCGCATGTTTTNG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000022185


For any suggestions or comments, please send an email to unitrap@crg.es