Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14168C2
Clone ID IST14168C2
Vector VICTR74
Project tigm

Sequence tag IST14168C2HMF1
Sequence
ATTCCACCAGTCTGAAGCAGGAAGACTGCAAGTTCTAGGCCCACCTAGCTTATAGAGTGTTTATCTAGAAATAAACATTT
AATTGTCAGAAAACACATGAAAGTATTGGAATTAATCAAAACCATAATGAGACAGCATTTCACAGAGCTGAGGAAGCCAC
CTTAAAGTGTTTATAGGAACACCTATTGCACTGGCTAGTTTTGTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130662191..130662397 207
 
EST/CDNA Est Name
  AV131687.1


Sequence tag IST14168C2HMR1
Sequence
GAATTACAGGCATGTGCCAACATTCTTGCTCTTTATTAGTCATGTTTGCTTGTTGAGACANGGTGACCTANAACTCANAG
ATACACCTGCTTTTGTCTTCTGAGTGATAGGAGGCATGCACTGCCATACCCAGCTTGTTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI31250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130662394..130662537 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025340 (Rabgef1) NM_019983 RAB guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Rabgef1-001]


Sequence tag IST14168C2BBF1
Sequence
ATTCCACCAGTCTGAAGCAGGAAGACTGCAAGTTCTAGGCCCACCTAGCTTATAGAGTGTTTATCTAGAAATAAACATTT
AATTGTCAGAAAACACATGAAAGTATTGGAATTAATCAAAACCATAATGAGACAGCATTTCACAGAGCTGAGGAAGCCAC
CTTAAAGTGTTTATAGGAACACCTATTGCACTGGCTAGTTTTGTGTCAACTTGACACAGCTGGAGTTATCACAGAGAAAG
GAGCTTCAGTTGAGGAAATGCCTCCATGAGATACAACTGTAAGGCATTTTCTCAATTAGTGATCAAGGGGGAAAGGCCCC
TTGTGGGTGGGACCATCTCTGGGCTGGTAGTCTTGGTTCTATAAGAGAGCNGGCTGANCNAGCCAGGGGANGCNNGCCAN
TANNGAACATCCNTCCNCGGCTTCNGCNTNANCTCCTGNTTCCNGANCTGNNNGAGTTCCNGTCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000025340


For any suggestions or comments, please send an email to unitrap@crg.es