Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10960D4
Clone ID IST10960D4
Vector VICTR76
Project tigm

Sequence tag IST10960D4HMF1
Sequence
CTATAAGCCAATAAGTAGATCCCTTTAAGATACTATAAAGCATTTATTAAACTCTTTGACATTAAAATATTAGATTTTGA
AAATAAAGGTAAGACTTAAATAGTGTGCATGGGAATGCACTAAATAGTATGCACGGAGATACAATTTCTCTCTTTTTTGT
CTTTTAAGAAGTTAAAGTTTTAAAATTTTACAATACCTAAACCTTTGAATTAATAACTAGTTA

Sequence Type genomic DNA
Unitrap ID UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52079197..52079418 222
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 87789267..87789488 222
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124749502..124749723 222
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 91356408..91356629 222
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136940229..136940450 222
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52919771..52919992 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469503..7469724 222
NO GENE  


Sequence tag IST10960D4BBF1
Sequence
CTATAAGCCAATAAGTAGATCCCTTTAAGATACTATAAAGCATTTATTAAACTCTTTGACATTAAAATATTAGATTTTGA
AAATAAAGGTAAGACTTAAATAGTGTGCATGGGAATGCACTAAATAGTATGCACGGAGATACAATTTCTCTCTTTTTTGT
CTTTTAAGAAGTTAAAGTTTTAAAATTTTACAATACCTAANCCTTTGAATTAATAACTANTTGACNAAACATTTNANATA
CTTGGCTGTAAAGGGGCANTGACTAATTGCACTTTTAATCNATTTTTTTAAGGAGCAGTTGTAACTAGAAGGCTTGTAAA
GTTATTAANAGTTACATGTGCNTAATTNATTNATTAACTAGAAATATGCNTAAGCAATTGTAAATTTGANAATTAATAGT
ATCTGANGGATGAACAATTTAAGCNATTGCGAGCTNANANATATGGCATTGNNNNTNAATATACNAATTAANGTTTGATT
GTTNNNCATTTTAAAACACCNTCTACNGCACACNNCTNNNTNATCTGTGCTGGAANNNGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000048332


For any suggestions or comments, please send an email to unitrap@crg.es