Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0257
Clone ID GC0257
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0257
Sequence
CTATAGAGGAAGACTGTGGACTGATCAGAAGGTCCTCTTGAACTGGTTCACTTCCGGGCACTGTCTGCTGATCACTCAGT
GAGCTCTGAGATGCACTAACAGGCTGGGACACTTCCTCATGGACCTCCTCATCACTTAATCTTTCTACTTTGACCCGGAC
ATCTTCTTCTGTACCTAGAGGCAAGGTGGGTTTTGTGCTCTCACAAGTCACATAGTCAGCCACTCTTCTACCTGCCTCGG
ATGGGCCAGGCAATTCTAAAG
Sequence Type mRNA
Unitrap ID UNI19

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30861638..30861898 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047412 (CT025653.7-201) NM_172765 Zinc finger and BTB domain-containing protein 44 (BTB/POZ domain-containing protein 15) [Source:UniProtKB/Swiss-Prot;Acc:Q8R0A2]

 
Come back to gene ENSMUSG00000047412


For any suggestions or comments, please send an email to unitrap@crg.es