Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D003B07
Clone ID D003B07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D003B07
Sequence
AGCCCCCCAGGGTGTAGAGGGCGGTCGCGGCGGTCGCCTGGGCAGCGGTGGCAGAATGTTGGCTTCCAGAGCGCTGAGCC
TGATTGGCAAGAGAGCCATTTCTACTTCGGTGTGCCTTCGAGCACATG
Sequence Type mRNA
Unitrap ID UNI6307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123192202..123193282 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031818 (Cox4i1) NM_009941 cytochrome c oxidase subunit IV isoform 1 Gene [Source:MGI Symbol;Acc:MGI:88473]


SPLK-Sequence tag 3SD003B07
Sequence
CACCCTCTGCTTCCTGACACACGTGCATTCCTCCAGTGGGACCCAAGCCTCCTGTACTGCTCAGTTCTCACTTAGAGTGT
GAGCCCATGGGGGGGTACAGGTGCTTACTTGTTTCCTGACACTGCCATCCAGACATGTCCAGAGTTAGCCTCAGTGACCA
GTAGGCACTTGGTAAGTCCTTGGCTGCCAGGGTCACGGTGACCACCAAGACTCTGCAACAGTCGCCTTTCCCTTTTTGAA
TTTTATGTTCTGAGTATGAGACCCTGCGGTTGGGTCTCCATTTAGTCCAGTTGCTTGTGTGACTAACAACCCTCAGCCCT
GGTCCTGCCCCTGGTGACCGAGGGGCTGCTTAGGTCAGGCTTCCGTCTTAACCGTTGACCGTCACCGCCCTTCTGCCTAG
ACTGCCGTCCACACGGGGTTTCAGGCCTCTCCAATGTGTTGTAGGGAGTGTTGTGAAGAGTGAAGACTATGCTTTCCCCA
CTTACGCTGATCGGCGTGACTACCCCTTGCCTGATGTGGCCCATGTCACGATGCTGTCTGCCAGCCAGAAGGCGCTGAAG
GAGAAGGAGAAGGCCGACTGGAGCAGCCTTTCCAGGGATGAGAAAGTTCAGTGTGGGTATCAGAGGGGGTGCACAAACAC
TCAGTAGTGTGTGGAGGCGATTGCACTNGGTCAGCTCTCCCAGCTGGGCTTCTAGATACCCATTCCATACTGCTGGCTTG
GCCAAACGGGAGCCATGTGACCTCACAGTCATGTGACCTCGTGTCTGAGGGCTGTGCTCACAGCTCTTCATTTTCCCCTT
CATGTATGCNNNNGTGTGAGGGCAGG
Sequence Type genomic DNA
Unitrap ID UNI6307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123196181..123197007 811
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031818 (Cox4i1) NM_009941 cytochrome c oxidase subunit IV isoform 1 Gene [Source:MGI Symbol;Acc:MGI:88473]

 
Come back to gene ENSMUSG00000031818


For any suggestions or comments, please send an email to unitrap@crg.es