Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15004A10
Clone ID IST15004A10
Vector VICTR78
Project tigm

Sequence tag IST15004A10BBF1
Sequence
GGGCGAAGTGGGTGTGCTGGGTTCTGGTGATGGTGAGTGGTCTTGGTTCCTGTTAGTAAGATTCCTCCGTTTACCTTTCG
CCATCTGGTAATCTCTGGAGTTAGTAGTTATAGTTGACTCTGTTTAGAGATTGTTCTTCTGGTGATTCTGTTACCGTCTA
TCAGCAGACCTGGGAGACAGATTCTCTCCTCTGAGTTTCAGTGCTCAGAGCACTCTCTGCTGGCAAGCTCTCTTACAGGG
AAGGTGCGCANATATCTTGTATTTGGACCTCCTCCTGGCCGAANAAGAAGGCCCNAAACAAGACCTTTCTNANACNGTGT
GTTGCTTTGNCN
Sequence Type genomic DNA
Unitrap ID UNI29644 UNI31065 UNI31253

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 134033..134361 315
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 28229585..28229913 315
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 13740191..13740519 315
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 65440546..65440874 315
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 26127776..26128104 315
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 28188117..28188445 315
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022262 (Dnahc5) NM_133365 dynein, axonemal, heavy chain 5 Gene [Source:MGI Symbol;Acc:MGI:107718]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 7129128..7129456 315
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 22363171..22363499 315
 
EST/CDNA Est Name
  BY559399.1 - BY573808.1 - BY566802.1 - BY484981.1 - CA886748.1 - AI426759.1 - AI561760.1 - CJ168023.1 - BY302409.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 17417415..17417743 315
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71043086..71043414 315
 
EST/CDNA Est Name
  BY207432.1 - BM121959.2
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 38009984..38010312 315
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 10292333..10292661 315
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28624017..28624345 315
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 11918980..11919308 315
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029629 (Phf14) NM_029404 PHD finger protein 14 Gene [Source:MGI (curated);Acc:Phf14-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 62715106..62715434 315
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 14401106..14401434 315
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5641423..5641751 315
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049119 (1700012H17Rik) NM_173426 family with sequence similarity 110, member B Gene [Source:MGI Symbol;Acc:MGI:1916593]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5653578..5653906 315
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 46966879..46967207 315
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7843048..7843376 315
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 32129722..32130050 315
NO GENE  


Sequence tag IST15004A10HMF2
Sequence
GGGCGAAGTGGGTGTGCTGGGTTCTGGTGATGGTGAGTGGTCTTGGTTCCTGTTAGTAAGATTCCTCCGTTTACCTTTCG
CCATCTGGTAATCTCTGGAGTTAGTAGTTATAGTTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 91514523..91514638 116
NO GENE  


Sequence tag IST15004A10HMR1
Sequence
TAAGTGACAGTAAGACACTATCCAAAAAGCATATGGATTCCTAACCNCAGTCCTGTACCTTTTACACCACTAAAGTAAGT
TCCATTTCCCTTAGGGTCATTCTGAAACTGACATAAAATGGAGAGACNTGTCACCAGGAATGTTTTTAAAACAAATGTAG
GGACCTGAAGAGATGACCCAGCTGTTAAGAGTGCTTGCTGGGAAACTAGGACCAGAGTTTGGATTCTGTTTTCCAGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102033003..102033241 235
NO GENE  

 
Come back to gene ENSMUSG00000049119


For any suggestions or comments, please send an email to unitrap@crg.es