Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14305H7
Clone ID IST14305H7
Vector VICTR74
Project tigm

Sequence tag IST14305H7HMF1
Sequence
GTTCCCATCCCTGCCTTATCTAGTCTCTGTATTCCTACCTCCCTCATTAGCAGGGGCAGGGATCAGCCACTGCTACCCTA
CCTTACTGGGGAAGGACCACACCTCTCCAGGGCAGGGACCACTTGTGTCGAGGGTGAAAAAGAGAAACGTCAGCATAAGA
CATCCTAGCCCCAGTCGCCACTTCACACNNAN
Sequence Type genomic DNA
Unitrap ID UNI26002

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95480184..95480371 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]


Sequence tag IST14305H7HMR1
Sequence
GGAACAACAGGGTAATTTANAAGATGTGGAGACGAGGATTGGGGCACAGACCTGGAACTTCTGGGGGACACACACTATGT
AGCTCAGATTAGTGTGGAAATATAACCTTGCTCTCTCCCCCTTTCTCCCCAGCCCAGAAAAGCATGAGGGATACAGGCAC
CGCCCACTTCCTATTCTTTCTCAAGCTGCTTTTGTGGAAGTGATAAACATACACAGGACAGACCCCCAGGCAGGTCAGGT
ACACTTCTTGAGCTATCACACTGTANGTCTCTCACCCTGGANGATCCCTCTGGCANNGCTGANACCANGTGAAAAGCCNN
NNGGTACAGANCGGGCTANTCANTGGGTGGCACANNAAAACCACNAANGCNNNGTCTCTGGNACCCGTTTCAAGCCGGTT
CCANCTGGGACTGCTCCNNGACATGNNCACNNNAGCGGCNNNNNGTANTTGTGTANTAGGGGTANACNCNNAGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14305H7BBF1
Sequence
GTTCCCATCCCTGCCTTATCTAGTCTCTGTATTCCTACCTCCCTCATTAGCAGGGGCAGGGATCAGCCACTGCTACCCTA
CCTTACTGGGGAAGGACCACACCTCTCCAGGGCAGGGACCACTTGTGTCGAGGGTGAAAAAGAGAAACGTCAGCATAAGA
CATCCTAGCCCCAGTCGCCACTTCACACTGAAAATGATGCCCACCCCAGAAGTAATTTATTTTTTATTAAAGTTGGTTTT
GACATAAACATGCTCTTCGTTATGTTCATGGGGACCCCACCATCCGAGCAATGTGAGGCCAGATGTGGTGTGGGAAGAGG
AGCGGCATTTAGGGATGGGAGGAAGATGTGGTCCTCATGGGCTGTGGAGTGAGCTTCAAACCTGGGGCNNTCTGGATCAN
NGGCCTAANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95479964..95480371 400
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es