Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14830D4
Clone ID IST14830D4
Vector VICTR76
Project tigm

Sequence tag IST14830D4HMR1
Sequence
TAGTCNNTTATCGTCATGGCAGGAAGCATGGCAGCTTGCAGGCAGACATGGTGCTAGAGAACGAGCTGANAGTTCTACAT
CTCTTTGTTTTTGTTTGTTCTTTTGAGACATGTTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCTGTGGACCATGCTA
GCCTAGAACTCACAGAGATCTGCCTGTCTCTGCCTCCTGAATGCTGGGAGGTATACAACCATCTCCTGACTCGAGTTCTA
CATCTTGATCCNAAGGCAACAGGAAGGGACAGAGACNCTTCCTCCAACAAGGCCACACTTCCTAACANTGCTGCTTCCTG
TGGGCCTGTGGGGGCCATTTTTATTCNGTCNNNCN
Sequence Type genomic DNA
Unitrap ID UNI11791

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114391670..114392019 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042364 (Snx18) NM_130796 sorting nexin 18 Gene [Source:MGI Symbol;Acc:MGI:2137642]


Sequence tag IST14830D4HMF1
Sequence
GGAAGTGTACTAGAAATGTTTCAAAGTAGGGTAATAGGAAGGGCATTTATTTTCCCTAGGACATCTCTCATATTATGTTT
CTAGGTTTTACTTAAACCTTTGGCAACACAGCTACTTCCTGATATGTGAATCCCACACAAATGGGGAAAGAATAAAACTT
GGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 94070923..94071084 162
NO GENE  

 
Come back to gene ENSMUSG00000042364


For any suggestions or comments, please send an email to unitrap@crg.es