Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CJ0276
Clone ID CJ0276
Vector pGT0lxrT2
Project sanger

Sequence tag CJ0276
Sequence
CAACGACCCCCTCTCCCTAAATGGAGTTGGGCGGGGGGGAAATGAAAACTGAGTTGGTCTTTACTTTTTTTAAAAGAGAC
TTTTTGATCCAATGAGGCCCCACAAGTAACTGAGTTTGGGTCCTGGTTGGTTGCTTTATTTTTTTTCCTCCAAAATTTTA
CCCCTCCCCCCTGAGCCCGAGGTGCTGACGTCGCAAAAAAATTGGATAAAGCCACCATCATGGGTTCAGGTCCCATAGAC
CCCAAAGAACTGCTCAAGGGCCTGGATAGCTTCCTTACCCGGGACGGAGAAGTGAAGAGTGTGGATGGAATTTCCAAGAT
CTTCAGTCTAATGAAGGAGGCACGAAAGATG
Sequence Type mRNA
Unitrap ID UNI1370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36054454..36061006 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]

 
Come back to gene ENSMUSG00000039220


For any suggestions or comments, please send an email to unitrap@crg.es