Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11663H1
Clone ID IST11663H1
Vector VICTR76
Project tigm

Sequence tag IST11663H1BBF1
Sequence
CATAGGAAGTTATCAGAAATTTAGTCAAGAGATATGTGGCTGCAATGATAANAAACTCCAAAACAAATGAGGGGCTAACA
GAAGAAAATTTTAAGGTAATTTAATCATGAAGTGGGTAAATCTCTTAATATTTATCTGTCTGTCTATCACCCCCCTCACA
CTCTGCAACAGTTTTCCCCTGTCCACAGAGCTGCATTCAAGCCCTATTTTTTTCATTTCTTGGTATAATTTAATCTTCAT
AGAGTTTGACAATTCTAATTATAGAATTCCATTTTCCTATNCAATTCTTATTTTTTTTAAAAAAAATATACNTTTANTTG
ANCANTGGTGGTGCACTTCTTTAATCCCANCACTCAGGAGGCANANNCNGATAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 140820154..140820529 354
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041710 (Trpc5) NM_009428 transient receptor potential cation channel, subfamily C, member 5 Gene [Source:MGI (curated);Acc:Trpc5-001]

 
Come back to gene ENSMUSG00000041710


For any suggestions or comments, please send an email to unitrap@crg.es