Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14623E9
Clone ID IST14623E9
Vector VICTR74
Project tigm

Sequence tag IST14623E9HMR1
Sequence
AGAAAAGCTCTGATCNTTGTCAGCAGGAAGCAGACAGAGACTGCCCGGACGCTTGGGCTCTCTCCTTTCTCCCTTCATTC
TGTCTGTCTCCTAGCACGGTGGGATAGTGCTGCTTGCAGTCTGAGATGGTATCCCCTGCTTGGTCTCCTCTCTGAAAACA
CTGTGGCAGACCAGAGGTCTGCCTTATCAACCACGCAGGTGCTTCTCAGGCCAGTCAAGCTTACCATCNCNCGGGAATGG
AAAAACCNTCTGTGTGGAACTGANCNGCTTTAANAATANCTGTGTTTGAGAN
Sequence Type genomic DNA
Unitrap ID UNI17846

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121538901..121539191 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027238 (Frmd5) NM_172673 FERM domain containing 5 Gene [Source:MGI (curated);Acc:Frmd5-001]


Sequence tag IST14623E9HMF1
Sequence
TTCTCCAACACACCAGACTGATCCCCATAAAAAGCTGAACCCTCTAAAACCATGAGCTCAAACACAGAAGACTTCCTTTT
AAGTTGTTTTCCTCGGCAATACAAAGTCTAGCCAACATACCATATTTCCTCTATAAAGCAGAGAAAGGTCCTCTTCCTTC
ACCACCTCCCACAGACAGAACACACATCAGACAGACAGGAAGATCAAGGCTCACAGCTGCAACAGATCCCCTTCGCCTCT
ACTCTCCCCAGTAATGAAGAATAAGCCTGCAATATCAAGTGGAAGGAACAGACTTTACAGAGTGACTTCCCCCACACTGA
ACTACACTAGGTCAGATGTGTGACAAGCATTCCTCCTCTCTGGAAGGACAAAGTGTCNTAATGCTGGTGGTTTTATCCAT
AACTGACAGGCNANNTATGTACTGCTCTGTANAATTATCTTTCTATTGTTCNTTNANGTCNGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121539188..121539649 443
 
EST/CDNA Est Name
  BB638937.1 - BB591542.2 - BB619862.1


Sequence tag IST14623E9BBF1
Sequence
TTCNNCNNCNCACCANNCTGATCCCCATAAAAAGCTGAACCCTCTAAAACCATGAGCTCAAACACAGAAGACTTCCTTTT
AAGTTGTTTTCCTCGGCAATACAAAGTCTAGCCAACATACCATATTTCCTCTATAAAGCAGAGAAAGGTCCTCTTCCTTC
ACCACCTCCCACAGACAGAACACACATCAGACNGACAGGAAGATCAAGGCTCACAGCTGCAACAGATCCCCTTCGCCTCT
ACTCTCCCCAGTAATGAAGAATANGCCTGCNNTATCANGTGGAAGGAACAGACTTTACNGAGTGACTTCCCCCNCACTGA
NCTACACTAGGTCNNATGTGTGACAAGCATTCCNCCTCTCTGGANGGACAAAGTGTCNTANTGCTGGTGGTNNNANNNNT
NNNNGACANGCNNNNANGNACTGCTCTGTNNNANTATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BB638937.1 - BB591542.2 - BB619862.1


For any suggestions or comments, please send an email to unitrap@crg.es