Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14759E12
Clone ID IST14759E12
Vector VICTR76
Project tigm

Sequence tag IST14759E12HMR1
Sequence
TGCAAACTAAAAGGTCTTAAAAACTTTGGANATGGAGTTTTTTTTTTTTTTTTAAAA
Sequence Type genomic DNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30063345..30063401 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]


Sequence tag IST14759E12BBF1
Sequence
TTGGTTCAATTCCCAGCACCCACATGGCAGCTCACAACTGCCTGTAACTCCAATTCCAGGGGATCTGATATCCTCACAGA
CATACAAGGAAAGAAAAAAGCTTAACGTCTGCTAAACAACGATAATCACAAATGGTGTAAAAACAAAACTTTTTTTTTTG
AANCTTGCNTGTNCNTTTATAAANTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57291177..57291365 179
NO GENE  

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es