Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14425B1
Clone ID IST14425B1
Vector VICTR74
Project tigm

Sequence tag IST14425B1HMR1
Sequence
GACACCAGGTTTTAATTCTTGTTCATGTTCAAGTGGTCTCTGAAGATGGTTATCACAAGTGTGCGTTGAATGTGCTACNA
TGTTTTTTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI19256

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 67935282..67935391 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079614 (Seh1l) NP_082388 SEH1-like (S. cerevisiae Gene [Source:MGI Symbol;Acc:MGI:1919374]


Sequence tag IST14425B1BBF1
Sequence
GGCCCACTGGGGTCTCTCTCTTGGTGACATGAGTCTGCTGTGACCCCTTTGTCCCAGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29095282..29095344 63
NO GENE  

 
Come back to gene ENSMUSG00000079614


For any suggestions or comments, please send an email to unitrap@crg.es