Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D008G09
Clone ID D008G09
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D008G09
Sequence
CAGCCCGAGGCAAGAGGGAGCCAAGATCGACGCCAGTAAGAACGAGGAGGATGAAGG
Sequence Type mRNA
Unitrap ID UNI10932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 100407411..100407467 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000568 (Hnrnpd) NM_007516 heterogeneous nuclear ribonucleoprotein D Gene [Source:MGI Symbol;Acc:MGI:101947]


SPLK-Sequence tag 3SD008G09
Sequence
TTTTACCCGTGATTTCACTACTGGTTAAGAGATAAAATTTGTAGGGGTGTTGGGACAGTGGAGAAGGACTTGGAGTATAA
TGTTTAAGAAAATCTCAGTTCAGGCTGATTCTCTGCAGTCTGCTAATGGTTGTAC
Sequence Type genomic DNA
Unitrap ID UNI10932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 100405982..100406118 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000568 (Hnrnpd) NM_007516 heterogeneous nuclear ribonucleoprotein D Gene [Source:MGI Symbol;Acc:MGI:101947]

 
Come back to gene ENSMUSG00000000568


For any suggestions or comments, please send an email to unitrap@crg.es