Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14458E1
Clone ID IST14458E1
Vector VICTR74
Project tigm

Sequence tag IST14458E1HMR1
Sequence
NAANAACCNGGGACAAACTTGAACAAGCTGTGGCTGGGGTGAAGTTAAGCACACACCATGTGGGGGTCTGGCCCTGCTTC
CTCTTTTAGTACAAGCATTCAAGTGTACTTGGGACTTAGGAGTGATTTCTTTTTCTTCCNTCTTAATCCTTTCTGTTTCA
TACTGCCCACCTTTACTTTTTGAATTTCTTATACTAACCCCAATCGATCCAGGGGATCGATTAACTGAATTTGTTAATAG
TTTCTGTCNTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI27121

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76363887..76364139 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048490 (Nrip1) NM_173440 nuclear receptor interacting protein 1 Gene [Source:MGI (curated);Acc:Nrip1-001]


Sequence tag IST14458E1HMF1
Sequence
TTTCCTCTCAGAAGTAAGACTCAGACTCAAACATATTTACAAATGCCTTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76364138..76364190 53
NO GENE  


Sequence tag IST14458E1BBF1
Sequence
TTTCCTCTCAGAAGTAAGACTCAGACTCAAACATATTTACAAATGCCTTGGCCATGTAGCTACTGACTAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76364138..76364210 73
NO GENE  

 
Come back to gene ENSMUSG00000048490


For any suggestions or comments, please send an email to unitrap@crg.es