Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10204H3
Clone ID IST10204H3
Vector VICTR76
Project tigm

Sequence tag IST10204H3HMF1
Sequence
TGCCTATTGTCCCACTCCTACTGAAGGAGTAGGGTGGGTCTCTTTANCCNGGGGTTCAGAGCCAGCTTGGGGAAATGTAG
TTACACCTTTGTCTCAGAAGACAAAGCAAACGTGCAAAGCTCTATGGAAGAGCAAAGCAAGAGAAAGGAGACCTTGGTAT
CCCATCCTCTGCCTGGGCAGACAGAGGTTCAGGGAGGGTGCTTCTGAGACTTTCACATTCGCTGTTCAAAAGCTGCTACT
GAGGCTATCTGACCNCTATGCAGGAGCTAAGGGCTGACTCANANCTGANTCAGGAGGCCGAGCAGTGGGTGGGTGGGAGG
TCANGCTGTCCCTTTGGACTGGCACCGAGCTCTTTTGTCCTGGCCTCCCCAGTGAGAACGTCCTTTTGATCTTTANGCAC
ACCANGTTTCTGAGATCANAGTTAAATACNGTGGGTTTTTTTTTTTNNCN
Sequence Type genomic DNA
Unitrap ID UNI20749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89700513..89700958 424
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027947 (Il6ra) NM_010559 interleukin 6 receptor, alpha Gene [Source:MGI Symbol;Acc:MGI:105304]


Sequence tag IST10204H3BBF1
Sequence
ATGTAAGAGATTAATAACAAACAGAGGAAGCTTAGTATAAGCTATACAAAACTGCAATTGACTTTATAAAAACTAAACGT
TTGAAGATAAAATTTCTCCTTAAAAATCTATGTTGATTGAGCCGGGTATGATGGCGCATGCCTTTAATCCCAGCACTCGG
GAGGCAGAGACAGGCAAATTTCTGAGTTCAAGGCCAGCCTGGTCTACAAAGTGAGTTCTANGACAATCAAGGCTATACAN
ANAANCCCTATCTNNAAAAACAAAAAACAAAACAAAACAAAATCTATGTTGANGGCTANGGACAATGANGCAGAAACAGA
CAGATNGGGGCCTCTGTGAATTTGTAAGGCCCTGCCTCAAAAAATAAACATACTAACATACTTAAGTCNNCCTATGTTCA
NGGCCTGGCAAGATGGCTCCATGGGTACAAAGCTCTTCCTGTGTAANCTAACNACCTGANCTTGAGCCCTGGACCAGAAT
GGAAGTAACGAGCTGTGGATGGACAACTGTCCTTTAACCTCCCCACACATGCTGTGACATAAGCTCTNCTGNGTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 115545713..115546268 520
 
EST/CDNA Est Name
  CA752175.1 - BE916895.1 - BF169059.1 - BI691819.1 - BY744919.1 - BI873086.1 - BB626204.1 - BE554616.1 - BM944969.1 - BY741311.1 - CX225619.1 - CJ137427.1 - BQ712931.1 - CB593959.1 - AA794463.1 - BY208093.1 - BY155585.1 - BY161375.1 - BB871181.1 - BY158619

 
Come back to gene CA752175.1 - BE916895.1 - BF169059.1 - BI691819.1 - BY744919.1 - BI873086.1 - BB626204.1 - BE554616.1 - BM944969.1 - BY741311.1 - CX225619.1 - CJ137427.1 - BQ712931.1 - CB593959.1 - AA794463.1 - BY208093.1 - BY155585.1 - BY161375.1 - BB871181.1 - BY158619


For any suggestions or comments, please send an email to unitrap@crg.es