Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D009D04
Clone ID D009D04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D009D04
Sequence
CGCGCTCTTTTCTCGGGACGGTGGAGGCCGTGCAGCGTCGCCCATACTCCGAGCAAAGAACTGTGCCAGAGGCAGTCGAG
GTTAGTGAGGACTGCGAGGCAGACACTTTGCTGTGTTCAAATCCAAGTCAAG
Sequence Type mRNA
Unitrap ID UNI6843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98625029..98625891 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031311 (Nono) NM_023144 non-POU-domain-containing, octamer binding protein Gene [Source:MGI (curated);Acc:Nono-001]


SPLK-Sequence tag 5SD009D04
Sequence
ACTCAGCCGCCTTTACCGTGATTGTATTCTACAGCTTTAACAGTCGCCCACCAGGCAACCATATCAGCCTAGCAAGTTCA
CACTGGATTTCTCTAGCAGTTTTTCATTTAGTAATTTGACTCTTCTAAAATTGAGAGGACCTTGATTTAGATTTCAGATA
CCTGTGATTAATATGGTCCTGAACATGTCTGCAGGTATATCACACACAGTAGCTATAGTCTCTTTCATTGTGGTTAATCT
TAGGACGTGATAGGAGACAGAAATCCTAACTGCTGATCTCTGTAGTTAGGGTTTGGTAAGTTTATTTCTGCAAAATTATA
TTATTGCATTTAACATAGGAACATTTCTTTCATGCTTGGTACTTGCTGT
Sequence Type genomic DNA
Unitrap ID UNI6843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98626165..98626533 369
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031311 (Nono) NM_023144 non-POU-domain-containing, octamer binding protein Gene [Source:MGI (curated);Acc:Nono-001]


SPLK-Sequence tag 3SD009D04
Sequence
AGGGCGAGCTGTTCAGTCGCAATCTAGAGGCATGCTTAGGCTAAGACCCCTTGGGATCGAGCACATAACTTTTAGGACCG
TACATTGAAGTGTCTATTTTGAAATCCGGGGGCATGTGGAGAAACTATACAAGAACCTTTTAAATGCCTTTGGTTGTTAC
ACGTTATCCATGTACTCAGAAGGNAGAGTTGGTTGGATTTCTGACTTCCAGGACAACCAGGGCTACACAGAGAAAGAGAG
AAACCCTGTGTGTGGGCGGGGTGTTCACAAGAAAGAAAAACCATCCCCCCTGGTGTGAAACTTGTTGGCGAGGAGAAGGT
GCCCTCTGAGGTAAATGCCTACCCGGGGGAGCGAGGTCCGGGGAGACCTAAAGGTTTTTCTTCGCAGTTTGGGCGCACGG
GGGGGTGAAAGAAAGGAAGGAGGAAAATCCTTTGGGGGGGGGTTTAAACTTTTTTATATTGGCCAAATAGGGGAGAAACC
GTGTGGAGGCTTTCGTTGAGAAGCCCCGGGGCCTTTTCCTTCCTTTCTTTTTTCCTGTTTGTTTCCCCCCCCGGAAGAGG
GTTTTTTGGTGAGGGCCATTGTGTTTTCTGAAGAATCGCCTTAGAAAGGGGCTCTAGAAATTAAAAACTCCTGCCTTGGC
CCTCAGGGGGGGGGTAAAAAAGGGGGCGCCCACAAGATCGTCGTTGTTTTGGATCGCAAATTTTTTTTTTTTTGAAGGAG
AAATTATGTTTTTTTTTTGGGGAACAGGAAACAACCCCCTTCGCGGTTGTGAGCTGTGTTTAAAGAACCTTTCTTTTTTG
CTGGGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031311


For any suggestions or comments, please send an email to unitrap@crg.es