Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12635E12
Clone ID IST12635E12
Vector VICTR76
Project tigm

Sequence tag IST12635E12BBF1
Sequence
CATAGACGCTGGCAGACTGGTGCCTCATCTGTCGGGCACTTCGCTGAAGCTGGCATCTGGGANTGGGAGGGGACTTAAGC
ANANCTG
Sequence Type genomic DNA
Unitrap ID UNI15056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25690171..25690256 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]


Sequence tag IST12635E12HMF1
Sequence
CATANACGCTGGCNNACTGGTGCCTNANCTGTCGGGCACTTCGCTGAAGCTGGCATCTGGGANTGGGAGGGGACTTAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es